Determination for ingredients of genetically modified plants—Target sequencing methods

time: 2023-05-30 11:00:19
  • GB/T 38570-2020
  • in force

Basic Information

standard classification number

  • Standard ICS number:

    Mathematics, Natural Sciences >> 07.080 Biology, Botany, Zoology
  • China Standard Classification Number:

    General>>Basic Standards>>A21 Environmental Conditions and General Test Methods

associated standards

Publication information

  • publishing house:

    China Standards Press
  • Publication date:

    2020-03-01

Other Information

  • Drafter:

    Peng Hai, Chen Lihong, Fang Zhiwei, Zhang Jianan, Li Tiantian, Li Lun, Cui Yehan, Ma Aijin, Jia Yingmin, Chen Hong, Zhou Junfei, Zhai Wenxue, Xu Na, Liang Yong, Gao Lifen, Song Shufeng, Hu Meixia, Fu Xiqin, Zhang Jing, Yu Jinwen
  • Drafting Organization:

    Jianghan University, Wuhan Mingliao Biotechnology Co., Ltd., China National Institute of Standardization, Beijing Technology and Business University, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Hunan Hybrid Rice Rese
  • Focal point Organization:

    China National Institute of Standardization
  • Proposing Organization:

    China National Institute of Standardization
  • Publishing Department:

    State Administration for Market Regulation National Standardization Administration
Introduction to standardsDescription (Translated English) / download

Skip to download

Summary:


This standard specifies the method for determining plant genetically modified components by target sequence sequencing. This standard is applicable to the qualitative detection of exogenous genes and transgenic lines in plants and their products. The lower limit of qualitative detection (LOD) of exogenous genes in this method is 0.1% (copy number ratio between exogenous genes and internal standard genes).


Standard contentStandard content

Some standard content:

ICS07.080
iiikAa~cJouakAa
National Standard of the People's Republic of China
GB/T38570—2020
Determination for ingredients of genetically modified plants-Target sequencing methods
Published on 2020-03-31
State Administration for Market Regulation
National Administration of Standardization
Implementation on 2020-03-31
Normative reference documents
Terms and definitions
Reagents or materials
Instruments and equipment
Determination steps
Sampling and sample preparation
DNA extraction and purification.
Library construction
High-throughput sequencing|| tt||8 Quality Control
Result Analysis and Expression
Result Analysis
Result Expression
10 Anti-pollution Measures
Appendix A (Normative Appendix)
Appendix B (Normative Appendix)
Probe Sequence
Artificial DNA
iiikAa~cJouakAa
GB/T38570—2020
This standard was drafted in accordance with the rules given in GB/T1.1—2009. iiiKAa~cJouaAabzxz.net
GB/T38570—2020
Please note that some contents of this document may involve patents. The issuing agency of this document does not assume the responsibility for identifying these patents. This standard is proposed and managed by the China National Institute of Standardization. The drafting units of this standard are: Jianghan University, Wuhan Mingliao Biotechnology Co., Ltd., China National Institute of Standardization, Beijing Technology and Business University, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Hunan Hybrid Aquaculture Research Center, Shenzhen BGI Intelligent Manufacturing Technology Co., Ltd. The main drafters of this standard are: Peng Gou, Chen Lihong, Fang Zhiwei, Zhang Jianan, Li Tiantian, Li Lun, Cui Yehan, Ma Aijin, Jia Yingmin, Chen Hong, Zhou Junfei, Zhai Wenxue, Xu Na, Liang Yong, Gao Lifen, Song Shufeng, Hu Meixia, Fu Xiqin, Zhang Jing, Yu Jinwen. iiikAa~cJouakAa
1 Scope
Determination of genetically modified components in plants
Self-labeled sequence sequencing method
This standard specifies the method for determining genetically modified components in plants by target sequence sequencing. iiiKAa~cJouaKA
GB/T38570-—2020
This standard applies to the qualitative detection of exogenous genes and genetically modified lines in plants and their products. The qualitative detection limit (LOD) of the exogenous gene in this method is 0.1% (the ratio of the number of copies between the exogenous gene and the internal standard gene). 2 Normative references
The following documents are indispensable for the application of this document. For all references with dates, only the versions with dates apply to this document. For all references without dates, the latest versions (including all amendments) apply to this document. GB/T6682 Specifications and test methods for water used in analytical laboratories GB/T19495.2 Technical requirements for genetically modified product testing laboratories GB/T19495.3 Methods for extraction and purification of nucleic acids for genetically modified product testing GB/T19495.5-2018 Real-time fluorescence quantitative polymerase chain reaction (PCR) detection methods for genetically modified product testing GB/T19495.7 Sampling and sample preparation methods for genetically modified product testing GB/T27403 Laboratory quality control specifications for food molecular biology testing 3 Terms and definitions
The following terms and definitions apply to this document
Endogenous reference gene Genes that are ubiquitous in different plant species and have a constant copy number. 3.2
exogenous gene
Exogenous gene
Other biological genes transferred to humans using bioengineering technology that allow biological varieties to express new biological traits. 3.3
Control samplecontrolsample
Prepared in parallel with the sample to be tested, used to show whether the sample to be tested is contaminated during the sample preparation process. 3.4
template fragment
Template fragment
A template deoxyribonucleic acid (DNA) sequence inferred from a group of sequencing fragments with the same random barcode in high-throughput sequencing fragments.
Characteristic fragment of exogenous genecharacteristic fragment of exogenous geneA template fragment that contains exogenous genes but does not exist in nature. Note: It includes exogenous gene sequences containing artificially modified sequences, and sequences connected to exogenous genes and sequences other than the boundary sequences of exogenous genes in the species of origin.
GB/T38570--2020
4 Principle
iiiKAa~cJouaKA
Samples to be tested and quality control samples are obtained through sampling and sample preparation. Sample genomic DNA is extracted and fragmented, adapter sequences are connected, PCR amplification connection products are obtained, probes are used to capture amplification products, sequencing libraries are obtained by amplification capture products, high-throughput sequencing is performed, sequencing data are analyzed, quality control is performed, and test conclusions are drawn.
This method uses different sample barcodes to identify and control laboratory aerosol contamination: exogenous genes are identified and microbial contamination is distinguished through characteristic fragments of exogenous genes: multiple transgenic components are detected simultaneously through hybridization probes that match multiple transgenic elements. 5 Reagents or materials
Unless otherwise specified, only analytically pure reagents are used. 5.1 Water: GB/T6682
5.2 Library construction reagents
5.3 High-throughput sequencing kit
5.4 See Appendix A for probe sequences.
5.5 Artificial DNA sequencer: See Appendix B
6 Instruments and equipment
High-throughput sequencer.
7 Determination steps
Sampling and sample preparation
The sampling and sample preparation of the test sample
According to the method specified in GB/T1495.7.1.2 Quality control sample preparation
From the beginning to the end of the preparation of the test sample, expose 1g/μL of artificial DNA solution to the sample preparation environment as a quality control sample.
7.2 DNA extraction and purification
Extract and purify the DNA of the test sample and quality control sample according to the method of GB/T19495.3 or a genomic DNA extraction kit with the same effect.
7.3 Library construction
7.3.1 Overview
Construct the library using the library construction kit and its operating instructions. 7.3.2 DNA fragmentation
Use enzyme digestion or mechanical fragmentation to fragment the genomic DNA of the test sample and the quality control sample to 100bp~1000bp. 2
iiiKAa~cJouakAa
GB/T38570--2020
During fragmentation, the minimum amount of genomic DNA added refers to the minimum amount of DNA template added when the lower limit of quantification is 0.1% as specified in Appendix B of GB/T19495.5-2018.
7.3.3 End repair and adapter ligation
Perform end repair on the product obtained in 7.3.2 and connect the adapter sequence. The adapter sequence should include three parts: a universal sequence of about 20 bases, a random barcode sequence consisting of 8 bases, and a sample barcode sequence of 12 bases. Different test samples or quality control samples use different sample barcode sequences, and the same sample barcode sequence in the same laboratory is used only once within 30 days. Purify the ligation product according to the kit instructions. 7.3.4 PCR amplification
Use the universal sequence on the connector in 7.3.3 to design primers to amplify the product obtained in 7.3.3, and the number of amplification cycles is less than or equal to 15. Among them, the designed primer sequence includes the sequencing primer sequence of the high-throughput sequencer. Purify the amplification product according to the kit instructions. Mix the test samples or quality control samples with different sample barcodes of equal mass to form a mixed sample. The number of test samples or quality control samples in each mixed sample should not exceed 4. 7.3.5 Hybridization capture
Mix the probes in Appendix A at equal rates to form a mixed probe, and use the mixed probe to capture the product obtained in 7.3.4. Purify the captured product according to the kit instructions. 7.3.6 PCR amplification
Use the sequencing primer sequence of the high-throughput sequencer to 7.3.Amplify the product in step 5, and the number of amplification cycles is less than or equal to 20 to obtain a sequencing library. Purify the sequencing library according to the instructions of the kit. 7.4 High-throughput sequencing
Use the high-throughput sequencing kit and its operating instructions to perform high-throughput sequencing on the sequencing library, and set the amount of sequencing base data of each sample to be tested to be greater than or equal to 1G.
8 Quality control
Use the transgenic identification software to perform quality control on the obtained sequencing data, and output the quality control conclusion. The quality control procedure requirements are as follows:
When the quality control conclusion is that there is cross contamination during sample preparation, repeat the experiment from step 7,1. a)
b) When the quality control conclusion is that the number of template fragments is insufficient, increase the amount of genomic DNA and repeat the experiment from step 7.3 or before
When the quality control conclusion is that the library construction failed, repeat the experiment from step 7.3 or before. d) When the quality control conclusion is that the amount of sequencing data is insufficient, repeat the experiment from step 7.4 or before. e) When the quality control conclusion is that the sequencing data quality is qualified, the results are analyzed. Result analysis and expression
9.1 Result analysis
The number of characteristic fragments of exogenous genes (TEF) in the sample to be tested is calculated using the multi-locus multinucleotide polymorphism (MLMNP) transgenic identification software.
GB/T38570—2020
Result expression
iiiKAa~cJouaKA
When TEF<3, it is expressed as \No ×X exogenous gene (or XX transgenic strain) was detected. When TEF≥3, it is expressed as "×× exogenous gene (or ×X transgenic strain) was detected". 9.2.2
For samples from which DNA cannot be effectively extracted, it is expressed as "No nucleic acid component was detected". 9.2.3
Anti-pollution measures
The anti-pollution measures for the determination steps of 7.17.3.2 shall be implemented in accordance with the provisions of GB/T27403 and GB/T19495.2. A.1
Foreign gene probe sequences are shown in Table A.1~Table A.28. Table A1
Appendix A
(Normative Appendix)
Probe sequences
iiikAa~cJouakAa
GB/T38570—2020
35S of cauliflower mosaic virus Promoter (pCaMV35S) probe sequence Probe sequence (from 5 end to 3 end)
/T38570—2020
iiiKAa~cJouaKA
Cauliflower mosaic virus terminator (t35S) probe sequence Probe sequence (from 5 end to 3 end)
CGCTGAAATCACCAGTCTCTCTCTACAAATCTATCTCTCTCTATAATAATGTGTGAGTAGTTCCCAGATAAGGGAATTAGGGTTCTTATAGGGTTTCGCTCATGTGTTGACCATATAAGATAATAATGTGTGAGTAGTTCCCAGATAAGGGAATTAGGGTTCTTATAGGGTTTCGCTCATGTGTTGAGCATATAAGAAACCCTTAGTATGTATTTGTATTTGTAAAATGCTTCTATCAAT Table A.3
3 Probe sequence of the 35S promoter of Scrophularia mosaic virus (pFMV35S) Probe sequence (from 5 end to 3 end)
Table A.4 Probe sequence of the nopaline synthase gene promoter (pNOS) of Agrobacterium tumefaciens Probe sequence (from 5 end to 3 end)
AGGCGGGAAACGACAATCTGATCATGAGCGGAGAATTAAGGGAGTCACGTTATGACCCCCGCCGATGACGCGGGACAAGCCGTTTTACGTTTGGAACTGACAGAACCGCAACGA TTGAAGGGGACAAGCCGTTTTACGTTTGGAACTGACAGAACCGCAACGATTGAAGGAGCCACTCAGCCGCGGGTTTCTGGAGTTTAATGAGCTAAGCACATACGTCAGAAACCATTATTGCGCGTTTGGAGTTTAATGAGCTAAGCATACGTCAGAAACCATTATTGCGCGTTCAAAAGTCGCCTAAGGTCACTATCAGCTAGCAAATATT TCTTGTCAAAAATGCTCCACTGACGTTCCATAA Number
iiikAa~cJouakAa
GB/T38570—2020
5 Probe sequence table A.5 of the nopaline synthase gene terminator (tNOS) of Agrobacterium
Probe sequence (from 5 to 3 end)
CAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGA ATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCCCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTAC6 Neomycin phosphotransferase gene (NPTI) probe sequence Table A.6
Probe sequence (from 5 end to 3 end)
Table A.7 Hygromycin phosphotyrosine transferase gene (HPT) probe sequence Probe sequence (from 5' end to 3' end)
ATGAAAAAGCCTGAACTCACCGCGACGTCTGTCGAGAACTTTCTGATCGAAAAGTTCGACAGCGTCTCCGACCTGATGCAGCTCTCGGAGGGCXGAAGAATCTCGTGCTTTCAGCTTCGATCTCGTGCTTTCAGCTTCGATGTAGGAGGGCGTGGATATGTCCTGCGGGTAAATAGCTGCGCCGATGGTTTCTACAAAGATCGTTATGTTTATCGGCACTTTGCATCGGCCGCGCTCCCGATGCATCGGCCGCGCTCCCG ATTCCGGAAGTGCTTGACATTGGGGAGTTTAGCGAGAGCCTGACCTATTGCATCTCCCGCCGTGCACAGGGTTGTCACGTTGCAAGACCTGCCTGAAACCGA7
GB/T38570--2020
Table A7 (continued)
Probe sequence (from end 5 to end 3)
iiikAa~cJouakAa
| |tt||TTGCAG
CACGACTCOCGGCGTATATCCTCCGCATTCGTCTTOCCAATTGTCTTGACCAACTCTATCAGAGCTTGGTTGACGGCAATTTCGTGATGCAGCTTGGGCGCA GGT GATECGACLCAATCUTCGATUPGOAGECCGGACTGTUGCGCGT CAOIGTOGGGCGTAC
ACAAATXCCAOAAGCUOECTIUACCGATGGTGTTAGAAGTAICGC GATAGTGGLAAICEACFCCCCAGEACTGTCCMGECAAAGAAATAGC
P glucuronide hydantoin (GUS
probe room column 05 wall to 3 end
GTCCTGTAGAAACOCAACCCOTGAC
TCAAAAAACTGOACGGLCTCTGGCATCA TCTGGATCGCGAAAACTGTO
GAATTGATCAGCITGGRGOGAAAGCGCGTTACAAGAAGCCCTGTGCCAGGCAGTTTTAACGATCAGTTCGCCGATGCAGATTTCTAATTATGCG
GGCAA GTCT
GTATCAGCGCGAAGTCTTTATAACCGAAAGGTTGGCCAGCCAC
GTATCGTOTGCG TTCGATGCGGTCACTCATTACGGCAAAGTGTGGTC
ATAATCAGGAAGTG
Tip: This standard content only shows part of the intercepted content of the complete standard. If you need the complete standard, please go to the top to download the complete standard document for free.
Please remember: "bzxz.net" is the combination of the first letters of the Chinese pinyin of the four Chinese characters "standard download" and the international top-level domain name ".net". ©2024 Standard download websitewww.bzxz.net Mail:bzxznet@163.com